Restriction enzyme

A restriction enzyme (also restriction endonuclease) is an enzyme that cuts double-stranded DNA. The position where the enzyme cuts the DNA is determined by a sequence of nucleotides that differs for each enzyme. Cuts can either result in blunt or sticky ends. Restriction enzymes allow the splicing of DNA from one source (or species) into another. Note that the DNA sequences recognised by these enzymes are palindromic-the sequence on one strand reads the same in the opposite direction on the complementary strand.

Original sequence

 GTCAGCCTGAGTCTGATGCTGAC
 CAGTCGGACTCAGACTACGACTG

Blunt ends

 GTCAGCCTG AGTCTGATGCTGAC
 CAGTCGGAC TCAGACTACGACTG

Sticky ends

 GTCAGCCTG AGTCTGATGCTGAC
 CAGTCGGACTCAGAC TACGACTG

Today, restriction enzymes are an essential tool (like scissors) in molecular biology.

		Restriction enzyme
		A restriction enzyme (also restriction endonuclease) is an enzyme that cuts double-stranded DNA. The position where the enzyme cuts the DNA is determined by a sequence of nucleotides that differs for each enzyme. Cuts can either result in blunt or sticky ends. Restriction enzymes allow the splicing of DNA from one source (or species) into another. Note that the DNA sequences recognised by these enzymes are palindromic-the sequence on one strand reads the same in the opposite direction on the complementary strand. Original sequence GTCAGCCTGAGTCTGATGCTGAC CAGTCGGACTCAGACTACGACTG Blunt ends GTCAGCCTG AGTCTGATGCTGAC CAGTCGGAC TCAGACTACGACTG Sticky ends GTCAGCCTG AGTCTGATGCTGAC CAGTCGGACTCAGAC TACGACTG Today, restriction enzymes are an essential tool (like scissors) in molecular biology.
Refer to us with this code